Skip to content

celiosantosjr/simgenes

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 

History

30 Commits
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

Repository files navigation

Simgenes

Pipeline to simulate and create random genes with selected features.

Simgenes - Python package

https://img.shields.io/pypi/pyversions/Simgenes License: MIT

If you use this software in a publication please cite:

Santos-Júnior C.D., 2023. Simgenes: Random gene sequences simulator. GitHub Repository. Available in: https://github.com/celiosantosjr/simgenes/


Table of contents

  1. Introduction
  2. Installing
  3. Usage
  4. Contact

Introduction

Simulate random gene and protein sequences controlling for real parameters, such as GC content. The package simgenes rely on very common libraries, e.g. biopython, tqdm, and numpy. In a test with 1 million sequences generated using simgenes:

from simgenes import batch_random

batch_random(ofile='test_check', L=(30,1002), GC=None, transl=False, n=1_000_000)

The time to generate 1 million gene sequences was 2765 s, equivalent to say that simgenes can generate over 361 sequences per second on average. We obtained a file with gene sequences in a length ranging from 30 to 1002 bp, with a very even distribution:

drawing

Fig. 1 - Length distribution of generated genes in a simulation.

Also, the contents of the nucleotides in the genes ranged largely, but yet inside the limits established internally in the pipeline according to other authors. Another interesting trait is that in side tests with ranging lengths and GC contents, the Spearman's correlation between the expected GC content (input to the program) and the output sequences was 0.995 (P-value = 0.0) with a residual effect of the length of the final sequence (rho = 0.014, P-value=3.95e-07). Meaning that the initial assignment of a GC content is effective in the output - Not the case in the current example below illustrated.

drawing

Fig. 2 - GC contents distribution in genes from the simulation.

The 1 million genes generated did not match to any family of Uniprot, and did not cluster under CDHit at 95% of identity and 90% of coverage of the shorter sequence. In an annotation test with Antifams, we obtained none of these 1 million random sequences matching to that database, which suggests no homology to spurious predictions so far reported.

This system can easily be used to generate decoy sequences for multiple purposes. Our results suggest that random genes from simgenes definitely differ from the annotated genes, and well-known spurious predictions, being interesting to works involving filters of artifactual gene predictions.


Install

To install the package simgenes, you can easily create a conda environment:

conda env create -f simgenes_environment.yml
conda activate simgenes

Then, just install the simgenes:

python3 -m pip install simgenes

Usage

Simgenes has several functions to help the user to quantify randomness in the sequences or generate new sequences.

1. Entropy measurements

This function can be used by simply entering the protein or nucleotide sequence and returns the entropy measured, the maximum possible entropy, and the relative entropy measure - Note that for all entropy calculations, we rely on the Log2 approximating the measures to the Shannon Entropy. Example of usage:

from simgenes import entropy

# creating example sequences
seq = 'ATACAGATGCGAGTAAACGAGCAAAAA'
seq_aa = 'MKLMKLMLKLMLLLLLLAHHHHHHH'

H, maxH, Hrel = entropy(seq)

print('''For nucleotides
We measured an entropy of: {H},
a possible maximum entropy of: {maxH},
and as relative entropy of {Hrel}''')

H, maxH, Hrel = entropy(seq_aa)

print('''For amino acids
We measured an entropy of: {H},
a possible maximum entropy of: {maxH},
and as relative entropy of {Hrel}''')

2. Translate nucleotides into amino acid sequence

This function can be used by simply entering the nucleotide sequence and returns the translated sequence by using Standard Genetic Code, translation table 11. Example of usage:

from simgenes import get_prot

# creating example sequence
seq = 'ATACAGATGCGAGTAAACGAGCAAAAA'

protein = get_prot(seq)

print(protein)
# IQMRVNEQK

3. Check internal stop codons

This function returns the indexes of nucleotides from which an internal stop codon is formed in the first frame. For example in the sequence ATGTAAAAATTTTGA, this function would return a list with the indexes of stop codons in the sequence [1, 4]. With this information, one can easily (by multiplying by 3) check the position of such codons in the sequence: [3 - TAA, 12 - TGA]. Example of usage:

from simgenes import check_internal_stops

# get example sequence
seq = 'ATGAGGGAGGGGGTGGGGATGAGGGATGAAAGTGTAGGATAAGTGACGGGGTGTAAGGCTGGCTTGGTGGACC
TGCAATTGAATGGCAAGGGCGGAGTAGATGTGGTGAGTGGAGAGAAGGTGGGAAAGTGTCAAATTCATGTGGGACGGTGGT
GGTTGGAGGGTTGCGGGAAGATCGGTGTGTGGAAGTTAGTGGGTTAAAGGGAACGTGCAGTAGGGGGAGCAGCTGGACAGC
TGGAAGGCGGGTCTGAGCGGCGGGGTGGGGTGGGTGGGGCGGGTTGGGGGGTTGGTGGTGTGCGGGAAAATCGGTGGGGGG
TATGGGTTAGGGCGAGGGGGGGGTTCAGAAGTGTGGGTGGGCGAGGCGAATGAGGAAAGGAGGGGGAGGTGGGAATGTGTG
GGGGACATGCGGGTAGGGAGAGCGAGCGGGAGTTGGTGGGGGGGAGTGGGGTACGGGGTTGGATGAAGGAGTGATGGGAGC
GGTAGAGAAAGGCGCTGGAGGGAAGCGAAGGGTTAGTAGCGAAGCAAGGTGGTTTGGGCGACGAAATTCGGGTGGTAAGTT
ATAGTGGTATAGGCAGCAGGTAA'

stop_codons = check_internal_stops(seq)

# getting stops in the sequence:
for x in stop_codons:
   print(seq[x*3: (3+(x*3))])

# 'TAA'
# 'TAA'
# 'TGA'
# 'TGA'
# 'TAG'
# 'TAA'

# getting indexes of the stop codons:
for x in stop_codons:
    print((x*3, 3+(x*3)))

# (39, 42)
# (198, 201)
# (366, 369)
# (468, 471)
# (480, 483)
# (579, 582)

4. Determine random nucleotides distribution

Although users can easily attribute a GC content for the generated random sequence, the exact distribution of A, T, C, G is not allowed to be set. This is because we are interested on generating the most random gene sequences possibly, therefore, the distribution is mostly attributed by randomly selecting the proportions that add up to 100%, also respecting the GC proportion previously established. When user gives GC = -1, then the proportions are set to 25% for each nucleotide, alternatively user can attribute 0 or no value (None) to get a completely random distribution that respects the rule from Mir et al. (2012) that says bacterial ORFs present a GC content between 21.4% and 74.9% of GC. For example:

from simgenes import det_props

# using fixed proportions
# [a = 25.00%, t = 25.00%, c = 25.00%, g = 25.00%]
props = det_props(GC=-1)

# using completely random assignment
props = det_props(GC=None)
# alternatively:
props = det_props()
# as result, for example:
# [23.2, 22.5, 18.8, 35.5]
# in this case GC was randomly set to 54.3%

# using an established GC content
props = det_props(GC=66.7)
# as a result, we can have, for example:
# [a = 22.60%, t = 10.70%, c = 27.60%, g = 39.10%]

5. Getting a random length

Unless user specifies clearly one single length for the generated sequence (multiple of 3 because of codons counting), simgenes will attribute a random length to the gene. It is also possible to create a range for the length of this gene in a form of a tuple, e.g. (30, 300) in this case meaning that the gene should encode proteins of 10 to 100 codons in total (counting start and stop as well). If a length that is not divisible by 3 is selected by the user, then the program overules the input and select a random length. Usage example follows:

from simgenes import get_len

# getting a random length between 30 and 300
L = get_len(30, 300)

In simgenes, the length of genes by default varies between 300 and 900 bp, with an average of 819 bp as suggested by Rajic et al. (2005). It is also important to mention that it is possible to generate small genes as well by setting low multiple of 3 numbers, such as 30, 120, and so on.

6. Random gene

This function returns a gene (and) protein sequence. User can provide a range to the length of random genes, by attributing to L a tuple with min and max gene lengths in base pairs, respectively. Users also can provide a fixed gene length by using an integer, or yet conform with the randomly selected length from the range between 300 to 900 base pairs. Another parameter to be selected is the GC gc content (0-100) of the desired genes, in case it is not given, the program will select randomly the proportion of nucleotides between 21.4 <= GC <= 74.9 (typical GC content of ORFs). There is also the option GC=-1, which means that all nucleotides are expected at same frequency. If user wants the corresponding protein sequence for the generated gene, then just set the "trans" parameter as True. Examples of usage:

from simgenes import random_gene

L = [(30, 300), 333, 40, None]
gc = [-1, 75.2, None]
for m in L:
    for g in gc:
        s, p = random_gene(L=m, gc=g, trans=True)
        print(f'L={m}bp, GC={g}%, nt={s}, prot={p}')

7. Batch random - To generate a set of genes

The option "batch_random" is interesting when the users need to generate a set of random genes. It takes the same parameters of the random_gene function, such as length in bp (L), GC content (GC=0-100), translation (transl=True/False), and additionally accepts the outputfile address tag (as a string) and the number of desired sequences (n=int). If no parameter is given, this function should generate 1 million nucleotide sequences from 30 to 300 bp with GC=50.8%, not translating them, and saving them into a file named 'output_testseq.fna.xz'. Example of usage:

from simgenes import batch_random

batch_random(ofile='output_testseq',
             L=1500,
             GC=65.2,
             transl=False,
             n=1_000)

Contact

If you have any issues or want to contribute to the project, please contact the author Celio Dias Santos Junior.

About

Simulate random gene sequences controlling for real parameters, such as GC content.

Resources

License

Stars

Watchers

Forks

Packages

No packages published

Languages