Readme for FebRNA1 package by Tan-group at Wuhan University

FebRNA1 is a package for building RNA 3D structures with input their sequence and secondary structures based on coarse-grained fragment ensembles. The program of FebRNA1 is run in Python, and numpy, biopython and scipy modules are required.

Please run FebRNA1 as follows:

Run in the example dir

python ./Run.py (or python3 ./Run.py) (in the file directory depending on the installed Python version) .

According to corresponding instructions from FebRNA1, please input :

• (a) sequence information,
• (b) secondary structure in dot-bracket form,
• (c) number of structures required (n), and
• (d) whether all-atom construction is required accordingly.

Wait for a while (usually within several minutes) to obtain the results.

• (a) The results are placed in the './RESULT';
• (b) './RESULT/CG_Result' contains all the predicted coarse-grained conformations;
• (c) './RESULT/Select_Result' contains a selection of TOP-n coarse-grained conformations;
• (d) './RESULT/AA_Result' contains the rebuilt all-atom structures of selected coarse-grained structures.

An example is:

python Run.py 
Sequence:GCGGCACCGUCCGCUCAAACAAACGG
Secondary Structure:((((..[[[.)))).........]]]
Seleted Num(0=all):5
All-atom rebuilding?(y/n):y
Finish in folder ./RESULT
Running time :37.020s

If you have any questions about FebRNA1, please contact us by the email: zjtan@whu.edu.cn .

References:

[1] Automated and efficient fragment-ensemble-based building for large RNA 3D structures.(to be submitted)